Virus C4 in BALB/c and T-Cell Receptor V Activation of Natural Killer Cells by Mouse Mammary Tumor

نویسندگان

  • Randall Gill
  • Hong Wang
  • Horst Bluethmann
  • Antonio Iglesias
  • Wei-Zen Wei
چکیده

Lymphocytic infiltrates of BALB/c 14 hyperplastic alveolar nodule (HAN) have elevated natural killer (NK) activity, which correlates posi tively with the progression of C4 HAN to tumor. C4 HAN produces an infectious mouse mammary tumor virus, MMTV(C4), which encodes a superantigen that activates and deletes T-cells with the Vß2segment in the T-cell receptor. In this report, NK activation by both MMTV(C4) and MMTV(C4) superantigen was tested. NK activity was measured in naive BALB/c mice, BALB/c mice depleted of Vß2*T-cell, or Vß2-transgenic mice after they received injections of either purified MMTV(C4) or MMTV(C4)-infected splenocytes. Elevated NK activity was observed in BALB/c mice receiving MMTV(C4) or MMTV(C4)-infected splenocytes. Depletion of \ (12'. but not \ /!«',T-cells by specific anti-Vßhybridoma before injection of MMTV(C4)-infected cells reduced but did not elimi nate NK activation. NK activation in Vß2-transgenic mice occurred before massive CD4 T-cell deletion took place and was more pronounced than that in the nontransgenic littermates. These results indicate that MM IA activates NK cells through superantigen-dependent and -independent pathways and supports the role of MMTV(C4) in the augmented NK activity observed in C4 HAN infiltrates. The progression of C4 HAN to tumor represents a model system for the analysis of how tumorigenesis may be affected by lesion-associated viruses. INTRODUCTION Lymphocytic infiltrates isolated from BALB/c C4 preneoplastic HAN1 are enriched with NK cells, with nearly 30% of the infiltrating cells expressing the NK cell surface marker, ASGM (1). Infiltrate NK activity can be upor down-regulated in HAN-hearing mice by the treatment of poly(IC) to induce interferon production or with antiASGM to eliminate NK cells, respectively (2). We have investigated the potential role of NK cells in the progression of C4 HAN to tumor by treating C4 HAN-bearing mice with either poly(IC) or anti-ASGM. Poly(IC) treatment decreased the tumor latency period and increased tumor incidence, whereas treatment with anti-ASGM reduced tumor incidence (3). These data suggest that activation of NK cells by C4 HAN contributes to neoplastic progression. Further characterization of C4 HAN infiltrates demonstrated a spe cific deletion of Vß2+T-cells (4). Loss of Vß2is systemic, and Vß2-deleting activity can be transferred with lymphocytes from C4 HAN-bearing mice, suggesting that C4 HAN releases an agent that infects lymphocytes and causes T-cell deletion (5). The release of MMTV from C4 HAN was substantiated with the identification of a novel MMTV(C4) in the milk of C4 HAN-bearing, lactating females (6). V/32+ T-cells are deleted in the offspring of C4 HAN bearers and Received 9/10/93; accepted 1/11/94. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1This work was supported by National Cancer Institute Grants CA-42522 and T32 CACW531. 2 To whom requests for reprints should be addressed, at Department of Immunology, Breast Cancer Program, Michigan Cancer Foundation, l K) E. Warren Avenue, Detroit, Ml 48201. 'The abbreviations used are: HAN. hypcrplastic alveolar nodule; poly(IC), polyinosinic-polycytidylic acid; NK, natural killer; ASGM. asialo-GMi; MMTV. mouse mam mary tumor virus; LTR. long terminal repeat; Mt\°. mouse mammary tumor virus provirus; TCR. T-cell receptor; F1TC, fluorcscein ¡sothiocyanate; ORF. open reading frame; DMHM, Dulbecco's modified Eagle's medium. in naive mice which receive injections of MMTV(C4), supporting both the role of MMTV(C4) in Vß2T-cell deletion and the transmis sion of MMTV(C4) through milk. Both endogenous and exogenous MMTVs manifest superantigen activity; i.e., they activate and delete T-cells with a particular Vß(7). The superantigen is a type II membrane protein encoded by the ORF gene in the 3' LTR of MMTV (8, 9). Expression of the ORF product on MMTV-infected major histocompatibility complex II+ cells leads to the interaction and ultimate deletion of specific Vß-bearingT-cells. Distinct ORF sequences in the endogenous Mt\> and exogenous MMTV determine the particular TCR Vßspecificity (10). Based on the superantigen activity, there are at least two additional groups of exogenous MMTVs besides MMTV(C4), MMTV(C3H) and MMTV(GR), which cause Vßl4/15* T-cell deletion, and MMTV(SW), which deletes Vß6,-7, -8.1, and -9(11). T-Cell deletion by Mn>and MMTV superantigen has little impact on the general well-being of the host, yet all MMTV retain the ORF gene, suggesting a biological significance of the gene product. Our previous observations that NK activity is elevated in C4 HAN infiltrates and that it provides positive signals toward mammary tumorigenesis, lead us to hypothesize that MMTV(C4) infection and MMTV(C4) supe rantigen contribute to NK activation in C4 HAN. Infection by certain viruses has been shown to induce interferon production and NK ac tivation (12). Vß2+T-cell activation by MMTV(C4) superantigen also may lead to cytokinc production and NK activation. In this report we examined NK activation by both mechanisms. MATERIALS AND METHODS Mice. BALB/c mice, originally obtained from the Cancer Research Labo ratory (Berkeley, CA), were bred by brother-sister mating in our animal care facility. BALB/c(C4) mice infected neonalally by MMTV(C4) were inhred from the offspring of C4 HAN-implanted female BALB/c (6). Vß2-transgenic Bd.Tg2 mice were generated by microinjecting C57BL/6 X SJL F|-fertilized mouse eggs with a 22-kilobase DNA construct, which con tains a functional TCR gene, Vß2-DßI.I-Jßl.i (13). The transgene is domi nant, and heterozygous offspring express Vß2on over 98% of their peripheral T-cells. Male B6.Tg2 mice were bred with BALB/c mice and the offspring were screened by polymerase chain reaction using a 5' primer located in V/32 (5'GCAGGATCTCCAAAAGCAAC3') and a 3' primer located in Jßl.l (5'GTGAGTCTGGTTCCTTTACC3'). All transgenic and nontransgenic lit termates used in this study were produced by the B6.Tg2 x BALB/c cross. C4 HAN Line. HAN line C4 was developed from a mammary nodule in a 12-month-old female BALB/c mouse that had received 1.5 mg of dimethylbenz(a)anthracene at the age of 8-10 weeks and had carried a pituitary isograft for 12 weeks (14). The HAN line is maintained by serially implanting HAN tissue into mammary fat pads of 21-24-day-old female BALB/c mice, from which the normal mammary gland has been removed. The transplanted tissue grows and fills the fat pad within 10-12 weeks. Tumors arise in 70% of C4 HAN implants within 10 months. Antibodies. Hybridoma line Jlj.10, which produces cytotoxic rat antimouse Thy 1.2 antibody, was purchased from the American Type Culture Collection (Rockville, MD). Ascites fluid containing Jlj.10 monoclonal anti body was produced in BALB/c mice and used to remove T-cells by comple ment-mediated cytotoxicity. Hybridoma cell lines B20.6 (15) and KJ16 (16), which produce rat monoclonal antibodies to Vß2and Vß8.1-2,respectively, were obtained from Dr. P. Marrack (Denver. CO). Hybridoma line 14.2 (17), 1529 American Association for Cancer Research Copyright © 1994 on February 23, 2013 cancerres.aacrjournals.org Downloaded from MMTVIC4) INDUCES NK ACTIVITY which produces a rat monoclonal antibody to V/314, was provided by Dr. D. Raulet (Cambridge, MA). Hybridoma line SFR3-DR5, which produces a rat monoclonal antibody to human HLA-DR5, was purchased from the American Type Culture Collection. All hybridoma cell lines were maintained in superenriched DMEM supplemented with 4% heat-inactivated fetal bovine serum (Hyclone Laboratories, Logan, UT), 10% NCTC 109 medium (Sigma Chemi cal Co., St. Louis, MO), 8 fig/ml bovine crystalline insulin (Sigma), 1 HIM oxaloacetic acid, 0.5 rnw sodium pyruvate, 2 ITIMi.-glutamine, 0.1 ITIMminimum essential medium, nonessential amino acids, 100 units/ml penicillin, and 100 H.g/ml streptomycin. Culture supernatant was used for immunofluorescent staining. Anti-ASGM and normal rabbit sera were purchased from Wako Chemical (Dallas, TX). FITC-conjugated anti-CD3 and anti-CD4 and phosphatidylcthanolamine-conjugated anti-CD8 were purchased from Pharmingen (San Diego, CA). i.v. Injection of Splenocytes. Spleens were removed aseptically from mice, single cell suspensions were prepared, and mononuclear cells were isolated by a one-step Histopaque-1077 (Sigma) gradient. Mice received i.v. injections of 5 X IO6 to 1 X IO7 splenocytes in 0.3 ml of phosphate-buffered saline. In some experiments the donor spleen cells were depleted of Thy-1.2+ cells before injection. To deplete Thy-1.2* cells, 5 X IO7 splenocytes/ml were incubated for 30 min at 4°Cin anti-Thy-1.2 ascites fluid at a 1:100 dilution and then incubated further with young rabbit complement (Pel Freez Clinical Division, Brown Deer, WI) at a 1:20 dilution for l h at 37°C.The antibody-complement cycle was repeated once and cells were washed three times in serum-free DMEM before injection. After antibody and complement treatment, the spleen cell preparations contained less than 0.1% Thy-1.2+ or CD3 + cells. In Vivo Depletion of T-Cells with Specific Vß. BALB/c mice were irra diated with 650 rads from a cesium source. At 24 h after irradiation, mice received i.p. injections of 1 X IO7 B20.6 or KJ16 hybridoma cells, both of which secrete rat IgG monoclonal antibodies specific for Vß2and Vß8, respectively. Mice thus treated developed neither tumor nor ascites. Vß2f T-cell profiles in the hybridoma recipients were monitored by flow cytometry. Purification of MMTV from Milk. At 7-14 days postpartum and 18-20 h before milk collection, nursing females were separated from their progeny. Approximately 15 min before milk collection, mice received i.p. injections of 0.3 unit of oxytocin (Parke-Davis, Morris Plains, NJ). Milk was aspirated by intermittent suction. MMTV was isolated from the milk according to the reported procedure (18). The milk was diluted with 3 volumes of 10 mm Tris-HCl (pH 7.5), 100 ITIMNaCl, and 5 ITIMEDTA and centrifuged at 600 x g for 10 min. The skim milk was collected and centrifuged at 15,000 X g for 70 min. The pellet was resuspended in 10 HIMTris-HCl (pH 7.5), 100 HIMNaCl, and 5 mvi EDTA; layered on a 20% sucrose gradient in 10 HIMTris-HCl (pH 7.5), 100 mm NaCl, and 5 mm EDTA and centrifuged at 180,000 x g for 3 h. The virus pellet was resuspended in phosphate-buffered saline at the original milk volume. Protein concentration was determined using the microplate DC protein assay (Bio-Rad Laboratories, Hercules, CA). Flow Cytometric Analysis of T-Cells. Lymph node cells were stained by incubating 1 x 10" cells in 100 ^1 of medium, with or without antibodies, for 45 min at 4°C.Monoclonal antibody SFR3-DR5 was used as the negative control. Excess primary antibody was removed by three washes and replaced by 50 n\ of FITC-conjugated F(ab')2 of mouse anti-rat IgG (Jackson ImmunoResearch Laboratories, West Grove, PA). The cells were incubated for an additional 45 min at 4°C.After the second incubation the cells were washed and resuspended in DMEM containing propidium iodide (20 fig/ml; Sigma) to exclude dead cells. To enumerate T-cells, lymph node cells were stained with FITC-conjugated anti-CD3 (Boehringer Mannheim Biochemicals, Indianapo lis, IN). Flow cytometric analysis was performed by FACStar (Becton Dick inson, Mountain View, CA) with a 2-W argon laser. Excitation was at 488 nm and emission was collected at 500-560 and 638-682 nm for FITC and pro pidium iodide, respectively. All experimental data were acquired on list mode for four correlated parameters and analyzed with a Consort 30 data analysis system. NK Cell Assay. YAC-1 cells were labeled with 5lCr by incubating 2 X IO6 cells with 100 fiCi Na51CrO4 (New England Nuclear, Boston, MA) in 0.5 ml superenriched DMEM at 37°C for 90 min. The unincorporated 5'Cr was removed by washing the cells three times with Hanks' balanced salt solution (GIBCO Laboratories, Grand Island, NY) containing 2% bovine calf serum. Graded numbers of effector cells were mixed with 2 X IO4 labeled YAC-1 cells in 200 fil of superenriched DMEM in the wells of round bottomed microtiter plates. After centrifugation at 200 X g for 1 min, the plate was incubated at 37°Cfor 4 h. After incubation, the plate was centrifuged at 480 X g for 10 min and a 100-/^1 aliquot was removed from each well for counting in a gamma counter. The percentage of specific lysis was calculated as % of specific lysis = cpm test cpm medium cpm max cpm medium X 100 The cpm max was determined by adding Vi,N HC1 to wells containing 51Crlabeled target cells only. Each group contained 4 replicates. RESULTS NK Activation by MMTV(C4)-infected Splenocytes. NK activa tion in BALB/c mice by MMTV(C4) or MMTV(C4) superantigen was tested with MMTV(C4)-infected splenocytes. Splenocytes were used because superantigen activity is mediated by MMTV-infected B-cells or dendritic cells (7, 8). Infection of splenocytes by MMTV(C4) was demonstrated previously by the expression of MMTV RNA in C4 HAN-bearing mouse splenocytes and the deletion of Vß2+T-cells in BALB/c mice that received injections of those splenocytes (5). Naive BALB/c mice received i.v. injections of 10-15 X IO6 splenocytes from C4 HAN-bearing BALB/c, MMTV(C4)-infected BALB/c(C4), or normal BALB/c mice; and NK activity of the recipient mouse

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Combined Extract of Heated 4T1 and a Heat-Killed Preparation of Lactobacillus Casei in a Mouse Model of Breast Cancer

Background: The adjuvanticity potential of Lactobacillus casei was first suggested in an old survey. The present study was designed to investigate the efficacy of a new immunotherapy against breast cancer made by mixing an extract of heated 4T1 mammary carcinoma cell line and a heat-killed preparation of Lactobacillus casei.Methods: Female BALB/c mice (6–8 weeks old, n=40) were challenged subcu...

متن کامل

Arteether Exerts Antitumor Activity and Reduces CD4+CD25+FOXP3+ T-reg Cells in Vivo

Background: Chemo-immunotherapy is one of the new achievements for treatment of cancer, by which the success of anti-cancer therapy can be increased. In vitro studies have been shown that Arteether (ARE) induces apoptosis in tumor cells, but not in normal cells. Objective: To investigate the cytotoxic and immunomodulatory properties of Arteether in-vivo and in-vitro. Methods: In this study, we ...

متن کامل

Intervention of T-cells in transportation of mouse mammary tumor virus (milk factor) to mammary gland cells in vivo.

Using BALB/c nu/nu, BALB/c nu/nufC3H (BALB/c nu/nu mice raised by C3H/HeN foster mother), BALB/c thymus-engrafted BALB/c nu/nufC3H, BALB/c nu/+, and BALB/c nu/+fC3H mice, we examined what kinds of cells are carriers of blood-borne mouse mammary tumor virus (B-MMTV). A radioimmunoassay and an immunoperoxidase assay revealed the presence of MMTV-gp52 antigen in the mammary glands of all BALB/c nu...

متن کامل

Correlation of natural killer activity with tumorigenesis of a preneoplastic mouse mammary lesion.

Tissue infiltrating lymphocytes isolated from the preneoplastic mouse mammary hyperneoplastic alveolar nodule (HAN) tissue line C4 express high levels of natural killer (NK) activity, which gradually wanes as spontaneous tumors develop (W. Z. Wei and G. Heppner. Br. J. Cancer, 55: 589-594, 1987). Experiments were performed to test whether modulation of NK cell activity would be associated with ...

متن کامل

Hyperthermia Increases Natural Killer Cell Cytotoxicity against SW-872 Liposarcoma Cell Line

Background: Although there is convincing data in support of the effectiveness of hyperthermia in tumor therapy, the molecular mechanisms underlying the clinical effects of hyperthermia are still poorly understood. Objective: To investigate natural killer (NK) cell cytotoxicity against heat-treated SW-872 and HeLa tumor cell lines. Methods: NKG2D ligands and HLA class I transcription were examin...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

عنوان ژورنال:

دوره   شماره 

صفحات  -

تاریخ انتشار 2006